#2299: Coronavirus Genome 2 explain

[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]

Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?

Megan: Sure.

Megan: …Why?

[Megan has turned to her her laptop typing on it, Cueball is off-panel.]

Cueball (off-panel): Nothing.

Megan: I … see.

Megan: Well, here you go.

Laptop: Click

[In “two” frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square “speech bubble” with a “speech line” going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]

Phone:

GAAAGGTAAGATGGAGAGGCCTTGTCCCTGGTTCAACGAGAA

-29,602 (+) Tweet

[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]

Cueball: Okay, it’s too long for Twitter, but it can fit in a Facebook post.

Megan: Unsettling that your first instinct is “share it online.”

Cueball: It’s cool, I sanitized my phone before posting.